ID: 1057162264_1057162269

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1057162264 1057162269
Species Human (GRCh38) Human (GRCh38)
Location 9:92896828-92896850 9:92896851-92896873
Sequence CCCACTGACTAGGCTTCCAATGA CTAGGTCACCAGGTCCCCATTGG
Strand - +
Off-target summary {0: 5, 1: 12, 2: 3, 3: 7, 4: 156} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!