ID: 1057171150_1057171159

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1057171150 1057171159
Species Human (GRCh38) Human (GRCh38)
Location 9:92963964-92963986 9:92964017-92964039
Sequence CCCTGCTGGGCCCCTCCTCCCTG GTCCACCCAGCAGAAGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 117, 4: 813} {0: 1, 1: 0, 2: 1, 3: 26, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!