ID: 1057245605_1057245619

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1057245605 1057245619
Species Human (GRCh38) Human (GRCh38)
Location 9:93451880-93451902 9:93451906-93451928
Sequence CCCGCCCGCACCCGCGCCCGCGC CGCCGCCGCCATGGGCGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 20, 3: 119, 4: 923} {0: 1, 1: 1, 2: 2, 3: 8, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!