ID: 1057350459_1057350465

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1057350459 1057350465
Species Human (GRCh38) Human (GRCh38)
Location 9:94292948-94292970 9:94292997-94293019
Sequence CCTTGGTTTTTTTTTCCTGTGAG CTCATCGAACAGCTGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 100, 4: 1017} {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!