ID: 1057644523_1057644528

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1057644523 1057644528
Species Human (GRCh38) Human (GRCh38)
Location 9:96860240-96860262 9:96860257-96860279
Sequence CCTGCTAATTGGAGAGCCCTGGG CCTGGGGCCTTGAGTGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 30, 3: 245, 4: 684} {0: 1, 1: 0, 2: 4, 3: 23, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!