ID: 1057702992_1057703003

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1057702992 1057703003
Species Human (GRCh38) Human (GRCh38)
Location 9:97376993-97377015 9:97377031-97377053
Sequence CCCTCCACCCCTGCTCTGTGCCG CCAGCGAACAGGACACAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 121, 4: 571} {0: 1, 1: 1, 2: 1, 3: 15, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!