ID: 1057790114_1057790121

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1057790114 1057790121
Species Human (GRCh38) Human (GRCh38)
Location 9:98119123-98119145 9:98119143-98119165
Sequence CCAGCCGCATCCCTCGACAAGCT GCTCCGACCTCCCAGGGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61} {0: 1, 1: 1, 2: 0, 3: 43, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!