ID: 1057869906_1057869922

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1057869906 1057869922
Species Human (GRCh38) Human (GRCh38)
Location 9:98709348-98709370 9:98709401-98709423
Sequence CCGCTGACCTCCAGGCACCAGAG CCGCGCGCTGGCACACGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 114, 4: 1088} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!