ID: 1058472939_1058472950

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1058472939 1058472950
Species Human (GRCh38) Human (GRCh38)
Location 9:105299719-105299741 9:105299770-105299792
Sequence CCTTCCTCCTTCTGCCTGTCCTA AATGAGTGGCATCTTTCGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!