ID: 1058529193_1058529205

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1058529193 1058529205
Species Human (GRCh38) Human (GRCh38)
Location 9:105889216-105889238 9:105889236-105889258
Sequence CCCTTGTTCCTGTCCCATCCCCA CCATCCCCATGGAGGCTGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!