ID: 1058575080_1058575082

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1058575080 1058575082
Species Human (GRCh38) Human (GRCh38)
Location 9:106392391-106392413 9:106392409-106392431
Sequence CCTTAACCTCTCTGAGCTGTGAC GTGACACACCCAAATGTGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!