ID: 1058590251_1058590261

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1058590251 1058590261
Species Human (GRCh38) Human (GRCh38)
Location 9:106557878-106557900 9:106557931-106557953
Sequence CCTCACTGTTGTCCTGGCTTCCT AAGCCACCTCACATCAGCCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!