ID: 1058624548_1058624557

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1058624548 1058624557
Species Human (GRCh38) Human (GRCh38)
Location 9:106921188-106921210 9:106921221-106921243
Sequence CCTAAATCCTGATGTAGAACAGG GGGTCATCCTGCTCTGACCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!