ID: 1059176731_1059176739

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1059176731 1059176739
Species Human (GRCh38) Human (GRCh38)
Location 9:112175142-112175164 9:112175168-112175190
Sequence CCGGCGCTCCCGCGGCGCCGCGG AGGCCGAGCAGCAGCAACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 322} {0: 1, 1: 0, 2: 2, 3: 29, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!