ID: 1059180442_1059180445

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1059180442 1059180445
Species Human (GRCh38) Human (GRCh38)
Location 9:112207371-112207393 9:112207394-112207416
Sequence CCTTCTTGTGGTCTACTTAGTGC CAGGTTTTTTGTATTTTTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 11, 3: 148, 4: 1602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!