ID: 1059197092_1059197097

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1059197092 1059197097
Species Human (GRCh38) Human (GRCh38)
Location 9:112380270-112380292 9:112380297-112380319
Sequence CCCGGCTGTGGGAGGTCAAGGAT CCTGGGCACGCTCTGAGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 317} {0: 1, 1: 1, 2: 3, 3: 22, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!