ID: 1059197092_1059197098

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1059197092 1059197098
Species Human (GRCh38) Human (GRCh38)
Location 9:112380270-112380292 9:112380307-112380329
Sequence CCCGGCTGTGGGAGGTCAAGGAT CTCTGAGCTCTGGTCCGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 317} {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!