ID: 1059404807_1059404819

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1059404807 1059404819
Species Human (GRCh38) Human (GRCh38)
Location 9:114093081-114093103 9:114093130-114093152
Sequence CCAGGGCAGAGGGAGCCCTAGGC CTGCAGCCCTGGAATCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 328} {0: 1, 1: 0, 2: 7, 3: 48, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!