ID: 1059405215_1059405223

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1059405215 1059405223
Species Human (GRCh38) Human (GRCh38)
Location 9:114095031-114095053 9:114095082-114095104
Sequence CCTGTGGTCGGGTGGTGACCCGC TGAGAGTCTCAGGAAGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 30} {0: 1, 1: 0, 2: 3, 3: 24, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!