ID: 1059437404_1059437409

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1059437404 1059437409
Species Human (GRCh38) Human (GRCh38)
Location 9:114284937-114284959 9:114284961-114284983
Sequence CCAGCCCGCAGGAGCTGTCAGAT CACATTCAGCACTATGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 146} {0: 1, 1: 0, 2: 5, 3: 19, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!