ID: 1059438067_1059438076

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1059438067 1059438076
Species Human (GRCh38) Human (GRCh38)
Location 9:114288411-114288433 9:114288443-114288465
Sequence CCAGGAGCAGGCGGTTTGCCCTA CTGTGTCCACAGGGGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81} {0: 1, 1: 0, 2: 1, 3: 34, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!