ID: 1059447343_1059447347

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1059447343 1059447347
Species Human (GRCh38) Human (GRCh38)
Location 9:114346691-114346713 9:114346710-114346732
Sequence CCGAGGCACTGAGGAAGACCTGG CTGGCTCGCTGCCTTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 317} {0: 1, 1: 0, 2: 2, 3: 22, 4: 298}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!