ID: 1060110534_1060110545

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1060110534 1060110545
Species Human (GRCh38) Human (GRCh38)
Location 9:120903614-120903636 9:120903667-120903689
Sequence CCTGACTTGTCTCAGGGTCTTTG GATAGGTGTGGGCCACCACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 229} {0: 1, 1: 0, 2: 4, 3: 69, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!