ID: 1060209086_1060209099

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1060209086 1060209099
Species Human (GRCh38) Human (GRCh38)
Location 9:121699437-121699459 9:121699481-121699503
Sequence CCGCCGCCGCGGACAATGAGAGG GTCCCCCGCGCCGCCGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 59} {0: 1, 1: 0, 2: 6, 3: 70, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!