ID: 1060209091_1060209099

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1060209091 1060209099
Species Human (GRCh38) Human (GRCh38)
Location 9:121699464-121699486 9:121699481-121699503
Sequence CCCGCCGCCGCCGCCCGGTCCCC GTCCCCCGCGCCGCCGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 127, 4: 946} {0: 1, 1: 0, 2: 6, 3: 70, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!