ID: 1060357045_1060357049

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1060357045 1060357049
Species Human (GRCh38) Human (GRCh38)
Location 9:122918940-122918962 9:122918977-122918999
Sequence CCACAGATTTTACACTGGAAAGG GCACACGCATGTGTCGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 221} {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!