ID: 1060406479_1060406490

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1060406479 1060406490
Species Human (GRCh38) Human (GRCh38)
Location 9:123375495-123375517 9:123375517-123375539
Sequence CCCCCCACACAAGAGGTATTTCC CACTGCAGGGAGAGCTTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138} {0: 1, 1: 0, 2: 4, 3: 29, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!