ID: 1060406805_1060406822

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1060406805 1060406822
Species Human (GRCh38) Human (GRCh38)
Location 9:123376899-123376921 9:123376948-123376970
Sequence CCTGCCTCCTCCTCCTCCTCCTG CCGAAAGCGCCGCCAGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 35, 2: 509, 3: 2020, 4: 6326} {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!