ID: 1060544701_1060544703

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1060544701 1060544703
Species Human (GRCh38) Human (GRCh38)
Location 9:124453109-124453131 9:124453128-124453150
Sequence CCTGAGCTGGCAGCGCTGACCGC CCGCGTGTACTCACGTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117} {0: 1, 1: 0, 2: 0, 3: 3, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!