ID: 1060548668_1060548676

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1060548668 1060548676
Species Human (GRCh38) Human (GRCh38)
Location 9:124475236-124475258 9:124475265-124475287
Sequence CCCTTCTGGTCCCCTGGCCTGCT CACAGCTACTCCTCCGCAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 365} {0: 1, 1: 0, 2: 0, 3: 16, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!