ID: 1060643860_1060643871

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1060643860 1060643871
Species Human (GRCh38) Human (GRCh38)
Location 9:125261774-125261796 9:125261827-125261849
Sequence CCCCGCGGCGCTGCGCACGCGCG CAGGGAAGCCAACAGGCGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 121} {0: 1, 1: 0, 2: 1, 3: 23, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!