ID: 1060794495_1060794504

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1060794495 1060794504
Species Human (GRCh38) Human (GRCh38)
Location 9:126504798-126504820 9:126504820-126504842
Sequence CCCGAGGATGCCCCTGGTGGGGG GTGGCCTTCTCAGGACTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 272} {0: 1, 1: 0, 2: 0, 3: 18, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!