ID: 1060816519_1060816534

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1060816519 1060816534
Species Human (GRCh38) Human (GRCh38)
Location 9:126638165-126638187 9:126638206-126638228
Sequence CCAGGTGAGCCCCTCTCTGCTGG CCCGACAGGAATGCTCCGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!