ID: 1060845918_1060845927

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1060845918 1060845927
Species Human (GRCh38) Human (GRCh38)
Location 9:126837513-126837535 9:126837538-126837560
Sequence CCCTGGGGAAGGGGATGTGCTGC CCTCCTGGGTGGGCGTGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 391} {0: 1, 1: 0, 2: 4, 3: 47, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!