ID: 1060874274_1060874280

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1060874274 1060874280
Species Human (GRCh38) Human (GRCh38)
Location 9:127069055-127069077 9:127069096-127069118
Sequence CCTGCCTCCTTCTTCATATGCAC CCTTAGTTCTGTCCAGGATTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 323} {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!