ID: 1060917960_1060917970

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1060917960 1060917970
Species Human (GRCh38) Human (GRCh38)
Location 9:127402605-127402627 9:127402657-127402679
Sequence CCTCCCTCATGCTGCTTCTCATG GCTGACTCAGCACAGGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 322} {0: 1, 1: 0, 2: 1, 3: 17, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!