ID: 1060938280_1060938282

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1060938280 1060938282
Species Human (GRCh38) Human (GRCh38)
Location 9:127528406-127528428 9:127528429-127528451
Sequence CCTTTTGCAAAAAGAAACATTTC TCAGATGCACTCATGGAGAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!