ID: 1060952265_1060952278

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1060952265 1060952278
Species Human (GRCh38) Human (GRCh38)
Location 9:127612017-127612039 9:127612043-127612065
Sequence CCCTGCGCCCCGGGCGCGCGCGG GTGAGGTGAGGGGGAGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 231} {0: 1, 1: 0, 2: 17, 3: 279, 4: 3087}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!