ID: 1061072981_1061072990

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1061072981 1061072990
Species Human (GRCh38) Human (GRCh38)
Location 9:128323073-128323095 9:128323101-128323123
Sequence CCACCTCCCCGCTGCAGAAAGGG GGCCGCCGGCTCCGCGGCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 254} {0: 1, 1: 0, 2: 6, 3: 18, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!