ID: 1061084921_1061084936

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1061084921 1061084936
Species Human (GRCh38) Human (GRCh38)
Location 9:128393118-128393140 9:128393163-128393185
Sequence CCCCGCCCAGCCCCGCGCACGCA TCCTGTGGCTGAGTCGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 610} {0: 1, 1: 0, 2: 2, 3: 10, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!