ID: 1061092414_1061092425

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1061092414 1061092425
Species Human (GRCh38) Human (GRCh38)
Location 9:128434086-128434108 9:128434119-128434141
Sequence CCATTGTATGCCACAGGTGGTTG GGCCCGGGTCCTGGTGTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 91} {0: 1, 1: 0, 2: 3, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!