ID: 1061149101_1061149113

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1061149101 1061149113
Species Human (GRCh38) Human (GRCh38)
Location 9:128818847-128818869 9:128818874-128818896
Sequence CCCGGGGGACCCCGCGGCCCGGG CTGGCCAAGTACGGGCTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 344} {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!