ID: 1061154084_1061154096

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1061154084 1061154096
Species Human (GRCh38) Human (GRCh38)
Location 9:128846675-128846697 9:128846724-128846746
Sequence CCCACCTTGGCTGGGTGACCCTG TCAGAATCCCTTCAGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 239} {0: 1, 1: 0, 2: 0, 3: 29, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!