ID: 1061183232_1061183239

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1061183232 1061183239
Species Human (GRCh38) Human (GRCh38)
Location 9:129037135-129037157 9:129037150-129037172
Sequence CCCGGTGCCCGGCATGGTGGGAC GGTGGGACTATTGAGGGGTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 21, 4: 268} {0: 1, 1: 0, 2: 1, 3: 6, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!