ID: 1061183233_1061183242

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1061183233 1061183242
Species Human (GRCh38) Human (GRCh38)
Location 9:129037136-129037158 9:129037157-129037179
Sequence CCGGTGCCCGGCATGGTGGGACT CTATTGAGGGGTCCGGCATGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 189} {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!