ID: 1061284291_1061284294

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1061284291 1061284294
Species Human (GRCh38) Human (GRCh38)
Location 9:129613421-129613443 9:129613437-129613459
Sequence CCCTGGAGCCTCACAGGCCAGCG GCCAGCGCAGTCCCAACACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185} {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!