ID: 1061418021_1061418025

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1061418021 1061418025
Species Human (GRCh38) Human (GRCh38)
Location 9:130458544-130458566 9:130458568-130458590
Sequence CCAGCGGGAGGGGGCCAAGTATG GTCCCACGGCGCCACAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 4, 3: 6, 4: 84} {0: 1, 1: 1, 2: 2, 3: 11, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!