ID: 1061430236_1061430246

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1061430236 1061430246
Species Human (GRCh38) Human (GRCh38)
Location 9:130526294-130526316 9:130526323-130526345
Sequence CCCCAGGAGGGCTGTGGCATCGG GACTGAGGCTGCCTGGCCGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 21, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!