ID: 1061537352_1061537365

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1061537352 1061537365
Species Human (GRCh38) Human (GRCh38)
Location 9:131258391-131258413 9:131258434-131258456
Sequence CCTGCAGCCTCTCCAGGGTGTTC AAGGGCAGAAAGAAGGGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 292} {0: 1, 1: 1, 2: 11, 3: 101, 4: 1037}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!