ID: 1061556963_1061556969

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1061556963 1061556969
Species Human (GRCh38) Human (GRCh38)
Location 9:131376600-131376622 9:131376623-131376645
Sequence CCTGTGTTTCCTTGTTAACACAA CTGGAAGTGGGAGTGGAACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 43, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!